Free download. Book file PDF easily for everyone and every device. You can download and read online Nature’s Versatile Engine: Insect Flight Muscle Inside and Out file PDF Book only if you are registered here. And also you can download or read online all Book PDF file that related with Nature’s Versatile Engine: Insect Flight Muscle Inside and Out book. Happy reading Nature’s Versatile Engine: Insect Flight Muscle Inside and Out Bookeveryone. Download file Free Book PDF Nature’s Versatile Engine: Insect Flight Muscle Inside and Out at Complete PDF Library. This Book have some digital formats such us :paperbook, ebook, kindle, epub, fb2 and another formats. Here is The CompletePDF Book Library. It's free to register here to get Book file PDF Nature’s Versatile Engine: Insect Flight Muscle Inside and Out Pocket Guide.

Nature Communications Molecular Biology of the Cell Journal of Cardiovascular Development and Disease 3: 18 doi Developmental Biology Biochemistry and Molecular Biology Education 3: PLOS One e PMCID: in progress Brunetti TM, Fremin B and Cripps RM Identification of singles bar as a direct transcriptional target of Drosophila Myocyte enhancer factor-2 and a regulator of adult myoblast fusion.


  • How to Be an International Tour Director and Travel the World ~ Third Edition.
  • Juan Jose Arredondo - اقتباسات الباحث العلمي من Google;
  • Virtual International Authority File.
  • Quantifying the Value of Project Management;

Arrest is a regulator of fiber-specific alternative splicing in the indirect flight muscles of Drosophila. Journal of Cell Biology, in press. Genetics: Developmental Cell. Methods In: Myogenesis: methods and protocols , DiMario J ed.

05 Asynchronous Indirect Flight Muscles

Springer, New York. Sequence motifs within the additional nucleotide of the 1. Of particular note is the cis element "acaccc" motif that has been identified as a binding site for MLP1 the human homologue of Drosophila Muscleblind protein [38]. This motif is required for the specific targeting of integrin alpha3 protein to distinct cytoplasmic loci [38]. Muscleblind in Drosophila is involved in alternative RNA splicing and is also required for terminal differentiation of muscle [39]. Further experiments will be needed to determine if sequences within the 3'UTR of the 1. The functional coupling between ANT and CK in vertebrate muscles has been the subject of many studies e.

By comparison, little is known about the putative interaction between ANT and AK in non-vertebrate muscle [12]. Available evidence suggest that insect flight muscle lacks a mitochondrial AK [12,13].

However, a mitochondrial AK has been identified in the cardiac muscle of the horseshoe crab and the blue crab [40]. While a direct interaction between AK and ANT has not been demonstrated, the localization of mitochondrial AK to the intermembrane space and the outer region of the inner membrane in the crab would be conducive for such interaction to occur. The shuttle function relies on the presence of a mitochondrial isoform at the production end and a myofibril isoform at the utilization end.

Fast skeletal muscle express the cytosolic CK isoform almost exclusively, while slow skeletal muscle and heart ventricular muscle express higher proportions of mitochondrial and myofibrillar CK isoforms [23]. However, we have confirmed the results of Wyss et al. It remains possible that a mitochondrial AK exists as originally reported, [43] that is not recognized by the antibodies used in this study and by Wyss et al.

While only one AK gene has been identified in the Drosophila genome, this gene is predicted to encode six different polypeptides flybase. Based on microfractionation studies of IFM fibers, Wyss et al. In contrast, Lang et al. Our immunoelectron microscopy results show that most of the AK is associated with the sarcomeric A band, with no detectable distribution in the cytosol. These seemingly contradictory results can be explained if the association of AK with the myofibril is weak and fails to endure the fractionation and isolation procedures used in prior investigations.

Coincidently, glycerination of Lethocerus IFM fibers has been shown to cause migration of zeelins from the A band to the Z band [45]. We speculate that the myofibril isolation procedure used by Lang et al. The redistribution is not unexpected assuming the interaction between AK and the myofibril is purely electrostatic, as has been shown for vertebrate CK and the sarcomeric M line [46]. Unlike vertebrate skeletal muscle, insect flight muscle is regarded to be functionally independent of phosphagens as evidenced by the low levels of AP in resting muscle and by low AK activity [47,48].

Nevertheless, the AK reaction plays a small role in providing metabolic capacitance during sustained flight [11,49,50]. Additionally, myofibrillar AK may be involved in phosphate Pi removal as increasing levels of Pi decreases work output at low ATP concentrations [4]. There is an interesting parallel between the situation in IFM and that of mice that are deficient for CK.

اقتباسات مكررة

In gas-trocnemius fast skeletal muscle of these mice, mitochondria are more abundant than in the muscle of normal mice and are relocated toward the A band, in an apparent attempt to minimize the diffusion distance of nucleotides as a way to overcome the absence of mitochondrial and cytosolic CK [51]. Cellular remodeling presumably to enhance direct nucleotide channeling between mitochondria and organelles also has been observed in the cardiac cells of CK deficient mice [23]. We suspect that the close.

The IFM phosphagen system evolved in conjunction with other features of the IFM that underlie this muscle's ability for fast and sustained contractions and high power output. Among these are a myosin motor with weak affinity for ATP [4], abundant mitochondria in close apposition to the myofibrils [6], and broad myofibrils with an increased number of force producing thick filaments [5]. These modifications impose certain challenges that the cellular energetic system must overcome in order for the muscle to operate effectively. Principal among these is the large diffusion distance for metabolites in the cell and more specifically, within the confines of the myofibril.

Fibers from asynchronous flight muscle have been reported to have a larger cross-sectional area than fibers from synchronous flight muscle [5]. A similar relationship is seen for myofibrils, those from asynchronous muscle have approximately twice the diameter and four times the cross-sectional area as those from synchronous muscle [5].

In crustacean tail muscle, limitations in phosphagen diffusion increase with increases in fiber size [52] and this raises the possibility that asynchronous muscles may face similar limitations. Previous studies have shown that ADP is the most diffusion constrained of all nucleotides [53].

Download Nature’S Versatile Engine: Insect Flight Muscle Inside And Out

It has been estimated that direct diffusion i. Taking these factors together we consider that diffusion of ATP and ADP alone provides a rudimentary, if any, metabolic capacitance in the IFM and therefore propose the existence of active mechanisms in these fast and powerful muscles. The existence of compartmentalized pools and direct channeling of nucleotides has been demonstrated in mouse heart [55].

More recently, the existence of structural barriers that restrict the diffusion of nucleotides and metabolites in.

While mitochondria are abundant and in close proximity to the myofibril, their ATP contribution may be spatially restricted to the periphery and other means of delivering ATP deep within the confines of the myofibril may be required. In addition to weak MgATP affinity, other kinetic properties of IFM myosin appear to dictate the need for a highly efficient mechanism for nucleotide transport within the myofibril. Unlike skeletal muscle, the rate-limiting step of IFM myosin is phosphate release, i. ADP is characterized by an inherently slow diffusion rate that in cardiac muscle is further restricted by intracellular structures and biochemical processes [57].

Publications - The Cripps Lab

Thus the need to prevent pools of high ADP concentration to build up in the vicinity of the myosin motors may be as important as maintaining high ATP concentrations. While myosin motor driven fluctuations may assist in diffusing ADP, the presence of ANT may facilitate directed transfer to the mitochondria that in turn stimulates mitochondrial oxida-tive phosphorylation. Our observation that ANT and AK have similar cellular and myofibrillar distribution patterns raises the possibility that these proteins might directly and more efficiently buffer ADP and provide sufficient ATP required for sustaining muscle contractions at high frequencies.

Further experiments will be needed to establish if and how ANT and AK, operating separately or together, contribute to nucleotide and phospha-gen diffusion in the IFM. In this study we used two complementary approaches, one direct and one indirect, to examine the intracellular distribution of ANT in Drosophila IFM. We created a transgenic line expressing a GFP-sesB fusion protein and showed, using anti-GFP specific antibodies and quantitative immunoelectron microscopy, that the fusion protein is equally distributed between mitochondria and myofibrils.

The distribution of the fusion protein is similar to that of the endogenous ANT observed using anti-ANT specific antibodies.


  • No Rest for the Dove!
  • Cold War Anthropology: The CIA, the Pentagon, and the Growth of Dual Use Anthropology.
  • Creating Choice: A Community Responds to the Need for Abortion and Birth Control, 1961-1973.

The novel finding of a myofibril localized ANT is consistent with the results of a prior study that found ANT to be present among the proteins of an IFM myofibrillar preparation [58]. Furthermore, we showed that AK is primarily localized to the sarcomeric. In summary, the quest for bigger myofibrils, necessary to achieve the high levels of power output required for flight, may have propelled the evolution of energy buffering systems within the confines of the myofibril.

Our results add to the growing body of evidence that phos-phagen-based energy systems are highly adaptable and remarkably versatile in meeting the cellular energetic demands of specific muscle types. These findings provide a new perspective on the versatility of cellular energy transfer pathways as their adaptation to meet the energetic demands of an ultrafast, strictly oxidative and high power muscle. More studies will be needed to fully understand how energy production and utilization are functionally integrated in insect flight muscle.

Drosophila melanogaster w, an otherwise wild type strain except for a white eye mutation, was obtained from the Bloomington Stock Center and was used as host for generation of transgenic lines and as a control line. The forward primer 5' attaccatggtgagcaagggc 3' with a Ncol restriction site shown in bold and a reverse primer 5' atta-tagcggccgccttgctt 3' with a Not I was used to amplify the coding region of the eGFP clone.

No customer reviews

The oligo dT primers 5' actagt-t 16 -i 3', 5' actagt-t 16 -a3', 5' actagt-t 16 - 3', 5' actcgt-t 16 -c3' were used for first strand synthesis. These primers have a single nucleotide 3' anchor bold italics preceded by oligo dT and the Spe I sequence. PCR was carried out using a forward primer that was specific to the sesB sequence at its 3' end and had a Not I restriction site at the 5' end. Using this combination of the forward primer and the anchored oligo dT, the. Homozygous strains were generated by single pair mating of siblings with the darkest eye color until no white eye progeny were produced.

Five independent lines were generated. This was repeated at least 4 times every day until late pupae stages. The next morning the acetone was removed and the flies spun for 1 hour in a speed vac after which the thorax was separated from the head, abdomen, wings and legs. The thorax was homogenized in Laemmli sample buffer with 8 mol L-1 urea and protease inhibitors [60]. Membranes were. TP synthase antibodies Rabbit polyclonal, provided by Rafael Garesse. Blots were incubated in primary antibody for one hour at room temperature followed by three washes for 15 minutes each in TBST Tris Buffer Saline 0.

The images were converted from color to gray scale in Adobe Photoshop. Transfections were performed using the Cellfectin reagent Invitrogen,.